pstBB [2018-02-13T13:36:59.000Z]

phosphate ABC transporter (ATP-binding protein)

Locus: BSU24950

Isoelectric point: 7.77

Molecular weight: 29.05 kDa

Protein length: 260 aa

Gene length: 780 bp

Function: high-affinity phosphate uptake

Product: phosphate ABC transporter (ATP-binding protein)

Essential: no

E.C.: 3.6.3.27

Synonyms: pstB,yqgK,yzmF

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of ions
• Metabolism → Additional metabolic pathways → Phosphate metabolism

Gene

Coordinates: 2,577,210 → 2,577,992

The protein

Catalyzed reaction/ biological activity

• ATP + H₂O + phosphate(Out) = ADP + phosphate + phosphate(In) (according to Swiss-Prot)

Protein family

• ABC transporter domain (according to Swiss-Prot)

Paralogous protein(s)

• ArtR, GlnQ, TcyC, TcyN, YvrO, YxeO

Expression and Regulation

Operons

• Genes: pstS-pstC-pstA-pstBA-pstBB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • PhoP: activation, PhoP-P, PubMed, in PhoP regulon

  Regulation

  • expressed under conditions of phosphate limitation (5000-fold induced) (PhoP) PubMed

  Additional information

  • mRNA processing between pstS and pstC to maintain higher concentrations of PstS relative to other components of the ABC transporter PubMed

Biological materials

Mutant

• MGNA-C450 (yqgK::erm), available at the NBRP B. subtilis, Japan
• BKE24950 (ΔpstBB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GGTAGCAATACTCATTGCCG, downstream forward: _UP4_TGAAAAAAACAGGCTGAGTC
• BKK24950 (ΔpstBB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_GGTAGCAATACTCATTGCCG, downstream forward: _UP4_TGAAAAAAACAGGCTGAGTC

Labs working on this gene/protein

• Marion Hulett, University of Illinois at Chicago, USA Homepage

References

Loading